View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6322_high_5 (Length: 254)
Name: NF6322_high_5
Description: NF6322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6322_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 161
Target Start/End: Complemental strand, 29959822 - 29959662
Alignment:
| Q |
1 |
ctatatatggttggtcttacatcaatggaattgactttcttgggagcttttcttgccgtctgggacattgttgttcttttgctgtaccttgataataatc |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29959822 |
ctatatatggttggtcttacatcaacggaattgactttcttgggagcttttcttgccgtctgggacattgttgttcttttgctgtaccttgataataatc |
29959723 |
T |
 |
| Q |
101 |
acactgaaaaagaaaattgcatcatactgataattaaattttgacagtgatctcgtagact |
161 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
29959722 |
acactgaaaaagaaaattgcatcacattgataattaaattttgacagtgatctcgtagact |
29959662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University