View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6322_low_6 (Length: 254)

Name: NF6322_low_6
Description: NF6322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6322_low_6
NF6322_low_6
[»] chr7 (1 HSPs)
chr7 (1-161)||(29959662-29959822)


Alignment Details
Target: chr7 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 161
Target Start/End: Complemental strand, 29959822 - 29959662
Alignment:
1 ctatatatggttggtcttacatcaatggaattgactttcttgggagcttttcttgccgtctgggacattgttgttcttttgctgtaccttgataataatc 100  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29959822 ctatatatggttggtcttacatcaacggaattgactttcttgggagcttttcttgccgtctgggacattgttgttcttttgctgtaccttgataataatc 29959723  T
101 acactgaaaaagaaaattgcatcatactgataattaaattttgacagtgatctcgtagact 161  Q
    |||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||    
29959722 acactgaaaaagaaaattgcatcacattgataattaaattttgacagtgatctcgtagact 29959662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University