View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6325_high_15 (Length: 237)
Name: NF6325_high_15
Description: NF6325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6325_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 16 - 176
Target Start/End: Original strand, 14442132 - 14442294
Alignment:
| Q |
16 |
acaatcactttttaagccgattcaaccgatcttaaaggtgc--gcgtgagttaacccacgctgaaaaatatcgaacgagaattaactcctattaaattaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| |||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14442132 |
acaatcactttttaagccgattcaactgatcttaaaggtgctagcgtgagttaacccacactgaaaaatatcgaacgggaattaactcctattaaattaa |
14442231 |
T |
 |
| Q |
114 |
gggaatgattttcgaatcagttagttgaacaaaccatgcggaccatgaacacccttgcctatt |
176 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
14442232 |
gggaatgattttcgaatcacttagttgaacaaaccatgcggaccatgaacatccttgcctatt |
14442294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 198 - 233
Target Start/End: Original strand, 14442292 - 14442327
Alignment:
| Q |
198 |
atttgctggatggtgacaaatttgtgtaggtgttcc |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
14442292 |
atttgctggatggtgacaaatttgtgtaggtgttcc |
14442327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 17 - 101
Target Start/End: Original strand, 25484982 - 25485068
Alignment:
| Q |
17 |
caatcactttttaagccgattcaaccgatcttaaaggtg--cgcgtgagttaacccacgctgaaaaatatcgaacgagaattaactc |
101 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||| ||| |||||||||||| ||||||| ||||| ||||||| || ||||||| |
|
|
| T |
25484982 |
caatcactttttaagccaattcaaacgatcttaaaagtggcagcgtgagttaactcacgctggaaaatgtcgaacgtgagttaactc |
25485068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 17 - 87
Target Start/End: Complemental strand, 32191196 - 32191124
Alignment:
| Q |
17 |
caatcactttttaagccgattcaaccgatcttaaaggtgc--gcgtgagttaacccacgctgaaaaatatcga |
87 |
Q |
| |
|
|||||| |||||||| | |||||||||||||||| |||| ||||||||||| | |||||||||||| |||| |
|
|
| T |
32191196 |
caatcattttttaagttggttcaaccgatcttaaaagtgccagcgtgagttaatctacgctgaaaaatgtcga |
32191124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 17 - 81
Target Start/End: Original strand, 25690753 - 25690819
Alignment:
| Q |
17 |
caatcactttttaagccgattcaaccgatcttaaaggtg--cgcgtgagttaacccacgctgaaaaa |
81 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||| || ||| ||||| |||||||||||| |
|
|
| T |
25690753 |
caatcactttttaagccggttcaaccgatcttaaaagtgtcagcatgaattaactcacgctgaaaaa |
25690819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 51
Target Start/End: Complemental strand, 16780811 - 16780777
Alignment:
| Q |
17 |
caatcactttttaagccgattcaaccgatcttaaa |
51 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
16780811 |
caatcactttttaagtcgattcaaccgatcttaaa |
16780777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 57 - 90
Target Start/End: Complemental strand, 37616304 - 37616271
Alignment:
| Q |
57 |
gcgtgagttaacccacgctgaaaaatatcgaacg |
90 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
37616304 |
gcgtgagttaacccacgctgaaaaatgtcgaacg |
37616271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University