View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6325_high_17 (Length: 201)
Name: NF6325_high_17
Description: NF6325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6325_high_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 182
Target Start/End: Complemental strand, 5650516 - 5650336
Alignment:
| Q |
1 |
agatgaaatatattgataccaacttgaaagtaagtctaatagcgaatccagagagtcttagtcatggaaagactttggacaccattgagggtcaaatatc |
100 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5650516 |
agatcaaatatattgataccaactcgaaagtaagtctaatagcgaacccagagaatcttagtcatggaaagactttggacaccattgagggtcaaatatt |
5650417 |
T |
|
| Q |
101 |
ctaattaccatagggttagaaaaatattggtaatacaataaatttgttaataatgcatctaagcttttaaaattgtccttta |
182 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5650416 |
ctaattaccata-ggttagaaaaatattggtaattcaataaatttgttaataatgcatctaagcttttaaaattgtccttta |
5650336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University