View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6325_high_2 (Length: 378)
Name: NF6325_high_2
Description: NF6325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6325_high_2 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 356; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 19 - 378
Target Start/End: Complemental strand, 6594095 - 6593736
Alignment:
| Q |
19 |
cctccgccgtctccggcgaagcatataagatcgcttctagctcgacggcgtggctccgttgaagtgtcgataccggaaggtggtgaagaggagactgtgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6594095 |
cctccgccgtctccggcgaagcatataagatcgcttctagctcgacggcgtggctccgttgaagtgtcgataccggaaggtggtgaagaggagactgtgg |
6593996 |
T |
|
| Q |
119 |
ttgctcttgataagaattttggattttccaagcattttggaagtagatatgaggttggagatgaggttggaagaggacattttggatatacttgtgctgc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6593995 |
ttgctcttgataagaattttggattttccaagcattttggaagtagatatgaggttggagatgaggttggaagaggacattttggatatacttgtgctgc |
6593896 |
T |
|
| Q |
219 |
gaggttgaagaaaggtgatcgcaaaggtcaacaagttgctgttaaagtcattcccaaagctaaggttctcatgcaaatcaatcactatttcaatgtttct |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6593895 |
gaggttgaagaaaggtgatcgcaaaggtcaacaagttgctgttaaagtcattcccaaagctaaggttctcatgcaaatcaatcactatttcaatgtttct |
6593796 |
T |
|
| Q |
319 |
atgagattaagcgtgtttgtatttgacttatttaagcttatccaccgatacataaatttg |
378 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6593795 |
atgagattaagcgtgtttgtttttgacttatttaagcttatccaccgatacataaatttg |
6593736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 124 - 218
Target Start/End: Original strand, 34200577 - 34200671
Alignment:
| Q |
124 |
cttgataagaattttggattttccaagcattttggaagtagatatgaggttggagatgaggttggaagaggacattttggatatacttgtgctgc |
218 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||| |||| ||| || |||| || || ||||| |||||||||||||| ||||||||| |||| |
|
|
| T |
34200577 |
cttgataagaattttgggttttcgaagcattttggtagtaagtatcagcttggtgaagaagttggtagaggacattttggttatacttgttctgc |
34200671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University