View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6325_low_14 (Length: 241)
Name: NF6325_low_14
Description: NF6325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6325_low_14 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 19 - 241
Target Start/End: Complemental strand, 11782515 - 11782292
Alignment:
| Q |
19 |
ttagtggcacgtcaatgtctcttaaggaaaattgtcatgtgtcaatgttacgtcaacatcgttaaaaagagttaacaagagggatcaattgtcattcgat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11782515 |
ttagtggcacgtcaatgtctcttaaggaaaattgtcatgtgtcaatgttacgtcaacatcgttaaagagagttaacaagagggatcaattgtcattcgat |
11782416 |
T |
 |
| Q |
119 |
gaattcttttaaagaaataagagtgaaagttaagataattagaaagaccaaagacatattcag-ccttttttcctttcaattaaactaagcatgcaaaag |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11782415 |
gaattcttttaaagaaataagagtgaaagttaagataattagagagaccaaagacatattcagcccttttttcctttcaattaaactaagcatgcaaaag |
11782316 |
T |
 |
| Q |
218 |
tacgctgtggtttcttttgaggct |
241 |
Q |
| |
|
|||| ||||||||||||||||||| |
|
|
| T |
11782315 |
tacgttgtggtttcttttgaggct |
11782292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University