View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6325_low_3 (Length: 374)
Name: NF6325_low_3
Description: NF6325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6325_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 1 - 354
Target Start/End: Complemental strand, 48767354 - 48766988
Alignment:
| Q |
1 |
aacagatcaaaactcgtcatgatcctgttaaatagagttgttgtatcagtatcacatacataatttgtagctaggaaaaatttgtagctagtaattatta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
48767354 |
aacagatcaaaactcgtcatgatcctgttaaatagagttgttgtatcagtatcacatacataatttgtagctaggaaaaatttgtagctagtaattacta |
48767255 |
T |
 |
| Q |
101 |
ctgctacatctaaacatggttccttgtcgtcatttgttgttcttagggttagttattttagtctaacgcaatataaacttaattatggcttgtatatgag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
48767254 |
ctgctacatctaaacatggttccttgtcgtcatttgttgttcttagggttagttattttagtctaacgcaatataaactgaattatggcttgtatatgag |
48767155 |
T |
 |
| Q |
201 |
taattatgagaaat-------------tatgttcacttgcaaattgcaactttaaaccgatcaacacaattatgtgccgaaacttgtcatgaacaaaggt |
287 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48767154 |
taattatgagaaatatgcattgatgtatttgttcacttgcaaattgcaactttaaaccgatcaacacaattatgtgccgaaacttgtcatgaacaaaggt |
48767055 |
T |
 |
| Q |
288 |
tcggattggtaaaaagtagctgatgatagataaactctattaagaatgtgttgcttaacattttaca |
354 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48767054 |
tcggattggtaaaaagtagcggatgatagataaactctattaagaatgtgttgcttaacattttaca |
48766988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University