View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6327_high_22 (Length: 250)
Name: NF6327_high_22
Description: NF6327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6327_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 7401076 - 7401284
Alignment:
| Q |
1 |
catatgcaggacttctaatttcacaagacttggacttcaaaatgtccaacttagtaatatacttgttactaaacaatgtttattaacagggaaatgctta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7401076 |
catatgcaggacttctaatttcacaagacttggacttcaaaatgtccaacttagtaatatacttgttactaaacaatgtttattaaaagggaaatgctta |
7401175 |
T |
 |
| Q |
101 |
tttgtacgggaataattagagaagaaatgcaagactgaacgagagccgtagatgcatgcaataaccaacccatgatctccgtcaaatacaaattgacagt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
7401176 |
tttgtacgggaataattagagaagaaatgcaagactgaacgagagccgtagatgcatgcaataaccaacccattatctccgtcaaaaacaaattgacagt |
7401275 |
T |
 |
| Q |
201 |
tctagcttc |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
7401276 |
tctagcttc |
7401284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University