View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6327_low_32 (Length: 238)
Name: NF6327_low_32
Description: NF6327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6327_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 166
Target Start/End: Original strand, 33334507 - 33334672
Alignment:
| Q |
1 |
cacatatttccactaaacccatatctactataggattgttgaggaagttgtcatccatattgccttcgatggtgttaccaatggagatccaagcaacaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33334507 |
cacatatttccactaaacccatatctactttaggattgttgaggaagttgtcatcgatattgccttcgatggtgttaccaatggagatccaagcaacaag |
33334606 |
T |
 |
| Q |
101 |
gcgcaactgtttctgcaaattagagcctttaaaaacatgcaaaaagaattaacaataggagtggat |
166 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33334607 |
gcgcaactgtttctgcaaattagagcctgtaaaaacatgcaaaaagaatcaacaataggagtggat |
33334672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 166 - 223
Target Start/End: Original strand, 33334696 - 33334754
Alignment:
| Q |
166 |
tccaattgttattattaatttatcttttaaactc-agtatttttaattcgagaggttca |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33334696 |
tccaattgttattattaatttatcttttaaactcaagtatttttaattcgagaggttca |
33334754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University