View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6328_high_39 (Length: 225)
Name: NF6328_high_39
Description: NF6328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6328_high_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 42203654 - 42203873
Alignment:
| Q |
1 |
ttattagttatatttagttgatacgtttaagttgttcttcattccattacagcttactcgctgatatgtatttttagtaacttatgatactgataatctt |
100 |
Q |
| |
|
|||||||| ||| ||||||||||| |||||| ||||||||||||||||||||||||| ||||||||| ||| |||| |||||||||||||||||||||| |
|
|
| T |
42203654 |
ttattagtaatagttagttgatacagttaagtggttcttcattccattacagcttacttgctgatatggattgttaggaacttatgatactgataatctt |
42203753 |
T |
 |
| Q |
101 |
gtcctatgatttaattaaattaaatgggatactaactatttggtcgcaaagtgtaagcattaacaatagctcaagaaatttgcaattgcctaagtttcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42203754 |
gtcctatgatttaattaaattaaatgggatactaactatttggtcgcaaagtgtaagcattaacaatagctcaagaaatttgcaattgcctaagcttcat |
42203853 |
T |
 |
| Q |
201 |
agtcaatattggtaaaattt |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
42203854 |
agtcaatattggtaaaattt |
42203873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University