View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6328_high_41 (Length: 217)
Name: NF6328_high_41
Description: NF6328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6328_high_41 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 203
Target Start/End: Complemental strand, 11406540 - 11406353
Alignment:
| Q |
18 |
aatagaacccaacattaattagttattaaattttctggtgaaatgttattataattttcaatgagaaaatctaataaggcctcccaaccctacaaatcac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11406540 |
aatagaacccaacattaattagttattaaattttctggtgaaatgttattataattttcaatgagaaaatctaataaggcctcccaaccctacaaatcac |
11406441 |
T |
|
| Q |
118 |
tagtgcacacgat--gtatatattttttagtattgtgtttgccctcaagaaattgattcaatattattaatggtgagtggggttgatg |
203 |
Q |
| |
|
||||||||||||| | |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11406440 |
tagtgcacacgatcgatgtatattttttagtattgtctttgccctcaagaaattgattcaatattattaatggtgagtggggttgatg |
11406353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University