View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6328_low_21 (Length: 339)

Name: NF6328_low_21
Description: NF6328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6328_low_21
NF6328_low_21
[»] chr2 (1 HSPs)
chr2 (301-339)||(14396411-14396449)


Alignment Details
Target: chr2 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 301 - 339
Target Start/End: Original strand, 14396411 - 14396449
Alignment:
301 gctgctagtgcgagttatttggagtacttgatcagcagc 339  Q
    |||||||||||||||||||||||||||||||||||||||    
14396411 gctgctagtgcgagttatttggagtacttgatcagcagc 14396449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University