View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6328_low_28 (Length: 262)
Name: NF6328_low_28
Description: NF6328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6328_low_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 20 - 250
Target Start/End: Original strand, 25623473 - 25623703
Alignment:
| Q |
20 |
ttaagcacactaaatagcacaaaatatattnnnnnnnngagtacaaagtgttgtcaaataggagctgtcgtgttcactattagaaatttgcaatttttct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25623473 |
ttaagcacactaaatagcacaaaatatattaaaaaaaagagtacaaagtgttgtcaaataggagctgtagtgttcactattagaaatttgcaatttttct |
25623572 |
T |
|
| Q |
120 |
gtagaatttcttgtggatttggagatcaagggtgaatggagtggtaatcggagatggtttgagttgtggttagtgatggttggtagtgatcggagtggcg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25623573 |
gtagaatttcttgtggatttggagatcaagggtgaatggagtggtaatcggagatggtttgagttgtggttggtgatggttggtagtgatcggagtggcg |
25623672 |
T |
|
| Q |
220 |
gtcaaagtgatgataggtgttggttgatgat |
250 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |
|
|
| T |
25623673 |
gtcaaagtgatgataggtgttggttggtgat |
25623703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University