View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6328_low_37 (Length: 238)
Name: NF6328_low_37
Description: NF6328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6328_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 78 - 223
Target Start/End: Complemental strand, 29185323 - 29185178
Alignment:
| Q |
78 |
aagagcctcgaatgctttgttagcctttaaaaattatgaaataacgagcacgtcactacaaaattataaaaatctattgtagtaattatgaaggtcttaa |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29185323 |
aagagcctcgaatgctttgttagcctttaaaaattatgaaataacgagcacgtcactacaaaattataaaaatctattgtagtaattatgaaggtcttaa |
29185224 |
T |
 |
| Q |
178 |
attaattgtttattttgatgtgttgtcttaaatttagtagattttt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29185223 |
attaattgtttattttgatgtgttgtcttaaatttagtagattttt |
29185178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 169 - 213
Target Start/End: Complemental strand, 32001705 - 32001661
Alignment:
| Q |
169 |
aggtcttaaattaattgtttattttgatgtgttgtcttaaattta |
213 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||| |||||| |
|
|
| T |
32001705 |
aggtcttaaattaattgttgattttgatgtgttgccttcaattta |
32001661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University