View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6328_low_38 (Length: 235)

Name: NF6328_low_38
Description: NF6328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6328_low_38
NF6328_low_38
[»] chr8 (1 HSPs)
chr8 (1-193)||(9623113-9623307)


Alignment Details
Target: chr8 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 9623307 - 9623113
Alignment:
1 atgtcaggaacgtttaacttaataaaatattgttccataaaaaattgaacttaaaatctttcaaacgattgattatttaataaaatttattaactatttg 100  Q
    ||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9623307 atgtcagaaacgtttaacttaacaaaatattgttccataaaaaattgaacttaaaatctttcaaacgattgattatttaataaaatttattaactatttg 9623208  T
101 agcttaa--nnnnnnnnnaatagattttacgtttgaaaaaagaaattgagagcccatggaacataggttttggattcatttaatcataaaagatt 193  Q
    |||||||           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9623207 agcttaatttttttttttaatagattttacgtttgaaaaaagaaattgagagcccatggaacataggttttggattcatttaatcataaaagatt 9623113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University