View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6328_low_39 (Length: 229)
Name: NF6328_low_39
Description: NF6328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6328_low_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 12 - 212
Target Start/End: Complemental strand, 23643680 - 23643480
Alignment:
| Q |
12 |
catagggaaacacaactcaaaaattaagaaagatggggaaagaggagtattatccattgtttgagacaaggagagggaagggaagactcatgtacataat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23643680 |
catagggaaacacaactcaaaaattaagaaagatggggaaagaggagtattatccattgtttgagacaaggagagggaagggaagactcatgtacataat |
23643581 |
T |
 |
| Q |
112 |
attctctttctctttgtttgtaggaatttgctctatttgggtttatagagtgagttatatacccaaaaaagatggaaaatgggtctggattggattgctt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
23643580 |
attctctttctctttgtttgtaggaatttgctccatttgggtttatagagtgagttatatacccaaaaaagatggaaaatgggtttggattggattgctt |
23643481 |
T |
 |
| Q |
212 |
t |
212 |
Q |
| |
|
| |
|
|
| T |
23643480 |
t |
23643480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 12 - 212
Target Start/End: Complemental strand, 23632585 - 23632385
Alignment:
| Q |
12 |
catagggaaacacaactcaaaaattaagaaagatggggaaagaggagtattatccattgtttgagacaaggagagggaagggaagactcatgtacataat |
111 |
Q |
| |
|
||||||||| |||||||||| |||||| |||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | | |
|
|
| T |
23632585 |
catagggaatcacaactcaagaattaacaaagatggcaaaagaggagtattatccattgtttgagacaaggagaaggaagggaagactcatgtacagagt |
23632486 |
T |
 |
| Q |
112 |
attctctttctctttgtttgtaggaatttgctctatttgggtttatagagtgagttatatacccaaaaaagatggaaaatgggtctggattggattgctt |
211 |
Q |
| |
|
|||||||||||| ||||| |||||||||| || ||||||||||| ||| ||||||| ||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
23632485 |
attctctttctcattgttaataggaatttggtccatttgggtttacagattgagttacatacccaaagaagatggaaaatgggtttggattggattgctt |
23632386 |
T |
 |
| Q |
212 |
t |
212 |
Q |
| |
|
| |
|
|
| T |
23632385 |
t |
23632385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University