View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6328_low_47 (Length: 204)

Name: NF6328_low_47
Description: NF6328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6328_low_47
NF6328_low_47
[»] chr2 (1 HSPs)
chr2 (17-185)||(38279353-38279522)


Alignment Details
Target: chr2 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 17 - 185
Target Start/End: Original strand, 38279353 - 38279522
Alignment:
17 tgaatgaaggtgtcgtgtctcagtctctt-gttaggcatgagtttttagctcattgttgctcccgacctacctgaactccacaacaagtgtattagtgtc 115  Q
    ||||||||||| | ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38279353 tgaatgaaggtctggtgtctcagtctctttgttaggcatgagtttttagctcattgttgctcccgacctacctgaactccacaacaagtgtattagtgtc 38279452  T
116 ttggttcggcttggtgagggagcgagagcaggaaattggtgtttggattaagtatagtgatgtggcatat 185  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38279453 ttggttcggcttggtgagggagcgagagcaggaaattggtgtttggattaagtatagtgatgtggcatat 38279522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University