View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6328_low_5 (Length: 565)
Name: NF6328_low_5
Description: NF6328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6328_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 279; Significance: 1e-156; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 1 - 339
Target Start/End: Original strand, 4554576 - 4554915
Alignment:
| Q |
1 |
attaaaaagcagcctgcctttgatcatcctgcattgaaaaatcacaaaattcaggtgaatgttcttcatgtgattccnnnnnnnnnnnnnnn-acaatac |
99 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4554576 |
attaaaaaacagcctgcctttgatcatcctgcattgaaaaatcacaaaattcaggtgaatgttcttcatgtgattccttttttttttttttttacaatac |
4554675 |
T |
|
| Q |
100 |
ttttgtgttaatttatagatgatacactagttgcttgtttgggctttcttttgtgaaagatcaatgtgattttaaaagtatgaaattaatttttacattc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4554676 |
ttttgtgttaatttatagatgatacactagttgcttgtttgggctttcttttgtgaaagatcaatgtgattttaaaagtatgaaattaatttttacattc |
4554775 |
T |
|
| Q |
200 |
tattttgtaaccatgtaattggtgcgaagtatccacggacttgtaccgattactaatctccgcatggaacttgcctggccaactttgacatgtttaagtg |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4554776 |
tattttgtaaccatgtaattggtgcgaagtatccacggacttgtaccgattactaatctccgcatggaacttgcctggccagctttgacatgtttaagtg |
4554875 |
T |
|
| Q |
300 |
ttcttgagtaaattgctttggacatccaaagtttattcta |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4554876 |
ttcttgagtaaattgctttggacatccaaagtttattcta |
4554915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 128; E-Value: 7e-66
Query Start/End: Original strand, 415 - 554
Target Start/End: Original strand, 4555003 - 4555142
Alignment:
| Q |
415 |
tgaacataagtaaataattttacactcaattcatttttaatcaaaatactttcgtcaaaatcaatttttgcccctgcaaaacaaaacacactaattagta |
514 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4555003 |
tgaacataagtaaataattttacactcaactcatttttaatcaaaatactttcgtcaaaatcaatttttgcccctgcaaaacaaaacacactaattagta |
4555102 |
T |
|
| Q |
515 |
attactacatgattgcttattgccaaatcactaatactac |
554 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
4555103 |
attactacatgttttcttattgccaaatcactaatactac |
4555142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 200 - 241
Target Start/End: Original strand, 43052348 - 43052389
Alignment:
| Q |
200 |
tattttgtaaccatgtaattggtgcgaagtatccacggactt |
241 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
43052348 |
tatttggtaaccatgtcattggtgcgaagtatccactgactt |
43052389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University