View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6329_high_8 (Length: 315)
Name: NF6329_high_8
Description: NF6329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6329_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 19 - 306
Target Start/End: Complemental strand, 7652662 - 7652375
Alignment:
| Q |
19 |
ctacgaggatgatggggttgacgttgatgacaaacttcatcgttttgatagtaattgttccgctgctactactgttactactgcttccacttaccgttca |
118 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7652662 |
ctacgacgacgatggggttgacgttgatgacaaacttcatcgttttgatagtaattgttccgttgctactactgttactactgcttccacttaccgttca |
7652563 |
T |
 |
| Q |
119 |
gctagtagtatacgtgaggtagatctgataccttctgaagcagtcaccgatcttcggtgtattgctgatagaatgatatcatctggatatcttcgcgaat |
218 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7652562 |
gctagtagtatacgtgagatagatctgataccttctgaagcagtcaccgatcttcggtgtattgctgatagaatgatatcatctggatatcttcgcgaat |
7652463 |
T |
 |
| Q |
219 |
gtattcaagtttacggcagtgtgaggaaatcagctgttgattcgagttttaagaaactcggtgttgagaagttgagtattgatgatgt |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7652462 |
gtattcaagtttacggcagtgtgaggaaatcagctgttgattcgagttttaagaaactcggtgttgagaagttgagtattggtgatgt |
7652375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University