View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6329_low_12 (Length: 257)
Name: NF6329_low_12
Description: NF6329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6329_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 954751 - 954999
Alignment:
| Q |
1 |
tctcttcctcatcgcttccattgtgtcaaacaagttgagatccttcattttttcaaaggtcaaaagaaatgacatgttacatttacaaacaaacnnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| |
|
|
| T |
954751 |
tctcttcctcatcgcttccattgtgtcaaacaagttgagatccttcattttttcaaaggtcaaaagaaatgacatgttacatttacataaaaaaaaaaaa |
954850 |
T |
 |
| Q |
101 |
ntagacacaagtattgatgagacatatttnnnnnnnnnnnnnnnnn--tacgaccaatatttgtgtctgtaattctcataattgataggctatttaccta |
198 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
954851 |
atagacacaagtattgatgagacatattttaaaaaaaaataaaataaatacgaccaatatttgtgtctataattctcataattgataggctatttaccta |
954950 |
T |
 |
| Q |
199 |
tgtcaaacaagtgaaatcctgcatttctaccccatcatcatcctctctg |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
954951 |
tgtcaaacaagtgaaatcctgcatttctaccccatcatcatcctctctg |
954999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University