View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6329_low_15 (Length: 223)
Name: NF6329_low_15
Description: NF6329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6329_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 19 - 151
Target Start/End: Complemental strand, 34743187 - 34743055
Alignment:
| Q |
19 |
tttctttgttgtgcggtgccggtagcaattgtgggaatatgagcgtatcacaagggtgatgtgtttgaggaatgatccttgtaacgctctgcaagggaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34743187 |
tttctttgttgtgcggtgccggtagcaattgtgggaatatgagcgtatcacaagggtgatgtgtttgaggaatgatccttgtaacgctctgcaagggaaa |
34743088 |
T |
 |
| Q |
119 |
tgtattaagaagcatatagcaaaaaattaagca |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34743087 |
tgtattaagaagcatatagcaaaaaattaagca |
34743055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University