View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6330_high_12 (Length: 237)
Name: NF6330_high_12
Description: NF6330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6330_high_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 19159082 - 19159305
Alignment:
| Q |
1 |
ccttcctttatttcatgtgatcagcctcaatggtatccacagggtgcacattctctttcccgtaggaacgataattggaacgcgtatgattatgcacctg |
100 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19159082 |
ccttcctttatttcacgtgatcaacctcaatggtatccacatggtgcatattctctttcccgtaggaacgataattggaacgcgtatgattttgcacctg |
19159181 |
T |
 |
| Q |
101 |
ataaccaccatcgcgtaggaccatggtatctctcgatcagactgcccttgcatagggaaattcatcgaaactgtgctgatcaaagaagttgttcttatcg |
200 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| | ||||||| |
|
|
| T |
19159182 |
ataaccaccatcgcgcaagaccatggtatctctcgatcgtcctgcccttgcatagggaaattcatcgaaattgtgctgatcaaagaagttatccttatcg |
19159281 |
T |
 |
| Q |
201 |
gaataatattgctgccaatctgga |
224 |
Q |
| |
|
|||||||| ||||||||||||||| |
|
|
| T |
19159282 |
gaataatactgctgccaatctgga |
19159305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University