View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6330_low_16 (Length: 206)

Name: NF6330_low_16
Description: NF6330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6330_low_16
NF6330_low_16
[»] chr1 (1 HSPs)
chr1 (19-173)||(26836211-26836365)


Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 19 - 173
Target Start/End: Complemental strand, 26836365 - 26836211
Alignment:
19 tgcatctcccatcatctctttcatggttgtgttgatactaatgatgaacgccttgagtcctttcatttattgtttcccgtcatggtaattggtaaatgat 118  Q
    |||||||| |||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26836365 tgcatctctcatcatctttttcatggttgtgttgataccaatgatgaacgccttgagtcctttcatttattgtttcccgtcatggtaattggtaaatgat 26836266  T
119 gaaagcaccaatgtgaagataagaaattaaacaaaagcaaatgtggaaatctcaa 173  Q
    |||||||||||||| |||||||||||||| |||||||||||||||||||||||||    
26836265 gaaagcaccaatgtaaagataagaaattatacaaaagcaaatgtggaaatctcaa 26836211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University