View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6331_low_15 (Length: 335)
Name: NF6331_low_15
Description: NF6331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6331_low_15 |
 |  |
|
| [»] scaffold0004 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0004 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 16 - 335
Target Start/End: Complemental strand, 374875 - 374556
Alignment:
| Q |
16 |
ataatcatcttcttcgactccggcagactcaggtgagacaggcaatattaggaaaaccaccaaaccaaggaaagacattattaatccgggcacaacgaaa |
115 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| |
|
|
| T |
374875 |
ataatcatcttcttcaactccggcagactcaggtgagacaggcaatattaggaaaaccaccaaaccaaggaaagacattattaatccaggcacaacaaaa |
374776 |
T |
 |
| Q |
116 |
gaccatccccatccatatcccaacatagcagaagcaatcaaagaaccagcaatgttcccgacagaagtatgagcattccaaattcccatgatcaaccctc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
374775 |
gaccatccccatccatatcccaacatagcagaagcaatcaaagaaccagcaatgttcccgacagaagtatgagcattccaaattcccatgatcaaccctc |
374676 |
T |
 |
| Q |
216 |
tcttccgctttccaaaccagttacccaaaaccgcaactacggatggccatccagtggattgaaacaaaccagaaatcatttgaatgactaaataatagta |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
374675 |
tcttccgctttccaaaccagttacccaaaaccgcaactacggatggccatccagtggattgaaacaaaccagcaatcatttgaatgactaaataatagta |
374576 |
T |
 |
| Q |
316 |
gaaattgtgattgtttcccc |
335 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
374575 |
gaaattgtgattgtttcccc |
374556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 157 - 297
Target Start/End: Complemental strand, 41288263 - 41288123
Alignment:
| Q |
157 |
agaaccagcaatgttcccgacagaagtatgagcattccaaattcccatgatcaaccctctcttccgctttccaaaccagttacccaaaaccgcaactacg |
256 |
Q |
| |
|
||||||| ||| ||||| ||||||||||| ||||||||||| ||||| ||||| |||||||||| ||| |||||||||||||| | ||| || || || |
|
|
| T |
41288263 |
agaaccactaatattcccaacagaagtatgtgcattccaaatacccattatcaaacctctcttcctcttcccaaaccagttaccgataacggcgacgacc |
41288164 |
T |
 |
| Q |
257 |
gatggccatccagtggattgaaacaaaccagaaatcatttg |
297 |
Q |
| |
|
|| ||||| || || | ||||||||| |||| ||||||||| |
|
|
| T |
41288163 |
gacggccaacccgtcgcttgaaacaacccagcaatcatttg |
41288123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University