View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6331_low_27 (Length: 241)
Name: NF6331_low_27
Description: NF6331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6331_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 136 - 222
Target Start/End: Original strand, 28154012 - 28154098
Alignment:
| Q |
136 |
tttgcggtttcacaatttcactgttttgaaccgccaggaatcaatcaattggttggtaggttggattccaaattcatatgaaaagca |
222 |
Q |
| |
|
|||| ||||||||||||| |||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28154012 |
tttgaggtttcacaattttactgttttgagccgccaggaatcaatcaattggttggtaggttagattccaaattcatatgaaaagca |
28154098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 136 - 222
Target Start/End: Original strand, 28188830 - 28188916
Alignment:
| Q |
136 |
tttgcggtttcacaatttcactgttttgaaccgccaggaatcaatcaattggttggtaggttggattccaaattcatatgaaaagca |
222 |
Q |
| |
|
|||| ||||||||||||| |||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28188830 |
tttgaggtttcacaattttactgttttgagccgccaggaatcaatcaattggttggtaggttagattccaaattcatatgaaaagca |
28188916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 138
Target Start/End: Original strand, 30311710 - 30311856
Alignment:
| Q |
1 |
tttctcaattcaactttcctcgttctcatttcatgtc----------tatataagatgtctctccattcataagtcttaatttattaaatttgaatttag |
90 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| ||||| |||||||||| |||||||||| || |
|
|
| T |
30311710 |
tttctcaattcaactttccttgttctcatttcatgtccatgcctttctatataagatgtctctccatttgtaagtattaatttattcaatttgaattcag |
30311809 |
T |
 |
| Q |
91 |
agaggttataggatataatacttggtaattgagatttttcggtgattt |
138 |
Q |
| |
|
||||||||||||| ||||| |||| |||| ||| ||||||||||||| |
|
|
| T |
30311810 |
agaggttataggacataatgcttgataatctaga-ttttcggtgattt |
30311856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University