View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6331_low_31 (Length: 219)
Name: NF6331_low_31
Description: NF6331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6331_low_31 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 16 - 168
Target Start/End: Original strand, 33534926 - 33535077
Alignment:
| Q |
16 |
tatggtacacgtttggtaggttgatatgtagtacatagagactttgaaatagtcatattcatatactagattcttggcatgaaacttgaagttaaagaat |
115 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33534926 |
tatggtacacgtttggtaggttgatatatagtacatagagactttgaaatagtcatattcatatactagattcttggcatgaaacttgaagttaaagaat |
33535025 |
T |
|
| Q |
116 |
gaaaggagcttaggtatgaactattacatcattctatgcattcgataatgaag |
168 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33535026 |
g-aaggagcttaggtatgaactattacatcattctatgcattcgataatgaag |
33535077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University