View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6332_high_19 (Length: 236)
Name: NF6332_high_19
Description: NF6332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6332_high_19 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 14 - 236
Target Start/End: Original strand, 6063231 - 6063453
Alignment:
| Q |
14 |
actattaaccaaactgttattaaacttgtgtttttctatggatactagatagtttggtggttaatattttaagacccacttcaattgttttgcaaattgg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6063231 |
actattaaccaaactgttattaaacttgtgtttttctatggatactagatagtttggtggttaatattttaagacccacttcaattgttttgcaaattgg |
6063330 |
T |
|
| Q |
114 |
tcccttttggatatactttcctctaaccacggtgtttgttgtgattatcaggtgggtttgcagtatctttctggagatatatccggtggcaatgctcgtt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6063331 |
tcccttttggatatactttcctctaaccacggtgtttgttgtgattatcaggtgggtttgcagtatctttctggagatatatccggtggcaatgctcgtt |
6063430 |
T |
|
| Q |
214 |
gtattgctatgcttcaggcattc |
236 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
6063431 |
gtattgctatgcttcaggcattc |
6063453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 161 - 235
Target Start/End: Original strand, 6745709 - 6745783
Alignment:
| Q |
161 |
tcaggtgggtttgcagtatctttctggagatatatccggtggcaatgctcgttgtattgctatgcttcaggcatt |
235 |
Q |
| |
|
||||||||||||||| || | |||||||||||||| |||||||||| |||||||||||| |||||||| ||||| |
|
|
| T |
6745709 |
tcaggtgggtttgcaatacatatctggagatatatctggtggcaatgatcgttgtattgcaatgcttcaagcatt |
6745783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University