View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6332_high_3 (Length: 419)
Name: NF6332_high_3
Description: NF6332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6332_high_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 349; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 349; E-Value: 0
Query Start/End: Original strand, 12 - 404
Target Start/End: Original strand, 8623608 - 8624000
Alignment:
| Q |
12 |
tgaatggacgtagagaagagatatgcaagaagattgttgaggcttgcgaggaatggggtatttttcaaattgttgatcatggtgttgacaccaaactcat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8623608 |
tgaatggacgtagagaagagatatgcaagaagattgttgaggcttgcgaggaatggggtatttttcaaattgttgatcatggtgttgacaccaaactcat |
8623707 |
T |
|
| Q |
112 |
atcggagatgacacatctttccagaaaattctttgctttgccaccggaagagaaacttcgtttcgatatgtccggtggcaagaagggtggtttcgttgtc |
211 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8623708 |
atcggagatgacacatctttccagagaattctttgctttgccaccggaagagaaacttcgtttcgatatgtccggtggcaagaagggtggtttcgttgtc |
8623807 |
T |
|
| Q |
212 |
tccagccacctccaagtaataatactaaccannnnnnnnnnnnatccattactatcatacatatatttatctggaaaatatatcctcttaaaacaaggtt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8623808 |
tccagccacctccaagtaataatactaaccatttttattttttatccattactatcatacatatatttatctggaaaatatatcctcttaaaacaaggtt |
8623907 |
T |
|
| Q |
312 |
caaattatagttgcattacaaacctaaatattgtggagaatttttatttaatgcttctaaaacaattttcgttgcacgatcttataaattttt |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8623908 |
aaaattatagttgcattacaaacctaaatattgtggagaatttttatttaatgcttctaaaacaattttcgttgcacgatcttataaattttt |
8624000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 35 - 96
Target Start/End: Complemental strand, 32069791 - 32069730
Alignment:
| Q |
35 |
tgcaagaagattgttgaggcttgcgaggaatggggtatttttcaaattgttgatcatggtgt |
96 |
Q |
| |
|
||||| |||||||| |||||||||||| | |||||||| || |||||||||||||||||||| |
|
|
| T |
32069791 |
tgcaacaagattgtggaggcttgcgagaactggggtatcttccaaattgttgatcatggtgt |
32069730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 28 - 96
Target Start/End: Complemental strand, 32092812 - 32092744
Alignment:
| Q |
28 |
agagatatgcaagaagattgttgaggcttgcgaggaatggggtatttttcaaattgttgatcatggtgt |
96 |
Q |
| |
|
|||||||||||| |||||||| || ||||| || | |||||||| |||||| |||||||||||||||| |
|
|
| T |
32092812 |
agagatatgcaacaagattgtagaagcttgtgaaaactggggtatctttcaagttgttgatcatggtgt |
32092744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University