View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6332_high_9 (Length: 294)
Name: NF6332_high_9
Description: NF6332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6332_high_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 278
Target Start/End: Original strand, 1793213 - 1793490
Alignment:
| Q |
1 |
taatctcaatcgttttgtcgtccacggtagccctacttgcttagagaagttaatttgtagttgtgtatggatgatatgcgcattctggtttttacaaata |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||| |||||||||||||| ||||||| |||| ||||||||||||||| |||||||||||| |
|
|
| T |
1793213 |
taatctcaatcgttttgtcgtccatggtagccctactagctttgagaagttaatttgcagttgtgcgtggaggatatgcgcattctgatttttacaaata |
1793312 |
T |
|
| Q |
101 |
atagcattaaaacgataactaaaatgaatagaggaataatattcgattttttctagctacaccctataaactttcagctactccataagttgacaaaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| ||||||||||||| |||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
1793313 |
atagcattaaaacgataactaaaatggatagaggaatagtattcgattttttttagctacaccctataaacgttcagctactccataagttgacgaaaat |
1793412 |
T |
|
| Q |
201 |
acccttaatccctttttaagcttttgatcaagtgattaaacttgacgctcgaaaagtttgagcagaaggtatccaaat |
278 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1793413 |
acccttagtccctttttaaactttcgatcaagtgattaaacttgacactcgaaaagtttgagcagaaggtatccaaat |
1793490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University