View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6332_low_11 (Length: 290)
Name: NF6332_low_11
Description: NF6332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6332_low_11 |
 |  |
|
| [»] scaffold0076 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 249; Significance: 1e-138; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 265
Target Start/End: Original strand, 38310400 - 38310664
Alignment:
| Q |
1 |
ttcacttggtttctctctctctgtcactgctatcttatatatctcacatgtatcgtatgattaccattgctgttattaccagcaaaatggggcttttatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38310400 |
ttcacttggtttctctctctctgtcactgctatcttatatatctcacatgtatcgtatgattaccattgctgttattaccagcaaaatggggcttttatt |
38310499 |
T |
 |
| Q |
101 |
gttgcttgtagtttcagcaacttttgcatgttgctttattattgaaagtgatcctgccagcttttgttgtagttcagagttgtactagttgcttattgtc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38310500 |
gttgcttgtagtttcagcaacttttgcatgttgctttattattgaaagtgatcctgccagcttttgttgtagttcagtgttgtactagttgcttattgtc |
38310599 |
T |
 |
| Q |
201 |
atgagtgattaccatttaatatgtgtaagttggttatagtaatatcagaagttgctcatcgtctc |
265 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38310600 |
atgaatgattaccacttaatatgtgtaagttggttacagtaatatcagaagttgctcatcgtctc |
38310664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 127 - 200
Target Start/End: Original strand, 38301863 - 38301933
Alignment:
| Q |
127 |
catgttgctttattattgaaagtgatcctgccagcttttgttgtagttcagagttgtactagttgcttattgtc |
200 |
Q |
| |
|
||||||| ||||||||||||||||||| || ||| ||||||| |||||||| |||| ||||||||||||||| |
|
|
| T |
38301863 |
catgttgttttattattgaaagtgatcttgtcagattttgttatagttcagtgttg---tagttgcttattgtc |
38301933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0076 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0076
Description:
Target: scaffold0076; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 71 - 147
Target Start/End: Original strand, 14407 - 14483
Alignment:
| Q |
71 |
tgttattaccagcaaaatggggcttttattgttgcttgtagtttcagcaacttttgcatgttgctttattattgaaa |
147 |
Q |
| |
|
|||| ||||||||||||| |||| | | |||||||||||||||| ||||||||| ||||| ||||||| |||||||| |
|
|
| T |
14407 |
tgttgttaccagcaaaattgggcctatgttgttgcttgtagtttgagcaactttagcatgctgctttaatattgaaa |
14483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University