View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6332_low_23 (Length: 228)
Name: NF6332_low_23
Description: NF6332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6332_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 17 - 208
Target Start/End: Complemental strand, 52476933 - 52476742
Alignment:
| Q |
17 |
agcaaaggtgattctaagaaacgagggagggaaattctcaaagaagtacataaagtcaatctccaagctcttgggtcccgatagcttgctatgtgcagct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52476933 |
agcaaaggtgattctaagaaacgagggagggaaattctcaaagaagtacataaagtcaatctccaagctcttgggtcccgatagcttgctatgtgcagct |
52476834 |
T |
 |
| Q |
117 |
gagcatcatcacaaactcattcgtagccgtctcttgagtttgttctcgcctcattctttgccttcctttgttcaactgtttgatgaacttgt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52476833 |
gagcatcatcacaaactcattcgtagccgtctcttgagtttgttctcgcctcattctttgccttcctttgttcaactgtttgatgaacttgt |
52476742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University