View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6332_low_25 (Length: 228)
Name: NF6332_low_25
Description: NF6332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6332_low_25 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 46433141 - 46432914
Alignment:
| Q |
1 |
tcatcacataaacacacaagtattctttctaaatattatcaagacagtaccggggatagggattatgccatttccctgatgcagaagccatgctaatgct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
46433141 |
tcatcacataaacacacaagtattctttctaaatattatcaagacagtaccggggatagggattatgtcatttccctgatgcagaagccatgctaatgct |
46433042 |
T |
 |
| Q |
101 |
aattgagaaggagtgcatgcatgctttgaagccaatacattgattctttcatagattatcttgttcttttccagatttactccaatgaacctgggatgca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46433041 |
aattgagaaggagtgcatgcatgctttgaagccaatacattgattctttcatagattatcttgttcttttccagatttactccagtgaacctgggatgca |
46432942 |
T |
 |
| Q |
201 |
tattctgttacagaaacaagaaggaatt |
228 |
Q |
| |
|
|||||||||||||||| | ||||||||| |
|
|
| T |
46432941 |
tattctgttacagaaaaaggaaggaatt |
46432914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 44 - 222
Target Start/End: Complemental strand, 46438740 - 46438562
Alignment:
| Q |
44 |
acagtaccggggatagggattatgccatttccctgatgcagaagccatgctaatgctaattgagaaggagtgcatgcatgctttgaagccaatacattga |
143 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
46438740 |
acagtaccagggatagggattatgtcatttccctgatgcagaagccaagctaatgctaattgagaaggagtgcatgcatgctttgaagccaagtcattga |
46438641 |
T |
 |
| Q |
144 |
ttctttcatagattatcttgttcttttccagatttactccaatgaacctgggatgcatattctgttacagaaacaagaa |
222 |
Q |
| |
|
||| |||||| | | |||||||||||||| |||| |||| ||||||| ||||||||| |||||||||||| ||||| |
|
|
| T |
46438640 |
ttcgttcataaaaaagcttgttcttttccaaattttctcctgtgaaccttggatgcatagcctgttacagaaataagaa |
46438562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University