View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6332_low_26 (Length: 224)
Name: NF6332_low_26
Description: NF6332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6332_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 21 - 217
Target Start/End: Original strand, 34387638 - 34387834
Alignment:
| Q |
21 |
attgcaagccatggaagtatgcattcattatggtatatgtgtttgcatggcatttcactagctgaaattccaagttcaaaaggctctttacaaacggcac |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34387638 |
attgcaagccatggaagtatgcattcattatggtatatgtgtttgcatggcatttccctagctgaaattccaagttcaaaaggctctttacaaacggcac |
34387737 |
T |
 |
| Q |
121 |
aatgtgattctacattcatatgactctcgttgatttcaatcgtcggtaacaattccaccgcggattttaatgccggtaaatgttgttgatgatgtcc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34387738 |
aatgtgattctacattcatatgactctcgttgatttcaatcgtcggtaacaattccaccgcggattttaatgccggtaaatgttgttgattatgtcc |
34387834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University