View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6332_low_5 (Length: 419)
Name: NF6332_low_5
Description: NF6332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6332_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 1 - 355
Target Start/End: Complemental strand, 53090667 - 53090314
Alignment:
| Q |
1 |
caagggcgccattcaggtccgtcaaagaggctgttacattattcggtgataaagttttagctggagagctctatgcaactgcaaccaaactcaaacacca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53090667 |
caagggcgccattcaggtccgtcaaagaggctgttacattattcggtgataaagttttagctggagagctctatgcaactgcaaccaaactcaaacacca |
53090568 |
T |
|
| Q |
101 |
ggttctatacaccatcacatcactcaattttattagaatatcaaaatggttaattacttgaattatttaaatcaccaataaggaattcttggacatttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53090567 |
ggttctatacaccatcacatcactcaattttattagaatatcaaaatggttaattacttgaattatttaaatcaccaataaggaattcttggacatttta |
53090468 |
T |
|
| Q |
201 |
attgaaggtccatccatcaataagattctcctatcctatgannnnnnnnngaaacagggtacaaactacaagtgcagattgtcatcaattttgcagagtg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
53090467 |
attgaaggtccatccatcaataagattctcctatcctatgttttttttttgaaacagggtacaaactacaagtgcagattgtcatcaa-tttgcagagtg |
53090369 |
T |
|
| Q |
301 |
tgtcatgtgcttgcttgtatttgtgtcttttgctttcttcaccgtctaattgaat |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53090368 |
tgtcatgtgcttgcttgtatttgtgtcttttgctttcttcaccgtctaattgaat |
53090314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University