View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6333_low_9 (Length: 238)
Name: NF6333_low_9
Description: NF6333
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6333_low_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 119 - 200
Target Start/End: Original strand, 31832628 - 31832709
Alignment:
| Q |
119 |
ttttaatggggtgatgtgaaagagtcttctgaatgaaaactgaagctgaggatttgatgggtaggattggattggtggatca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31832628 |
ttttaatggggtgatgtgaaagagtcttctgaatgaaaactgaagctgaggatttgatgggtaggattggattggtggatca |
31832709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 7 - 59
Target Start/End: Original strand, 31832516 - 31832568
Alignment:
| Q |
7 |
catcatcaccatcattgttcttgacaccacgtagttcaagtattgttgtagtt |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31832516 |
catcatcaccatcattgttcttgacaccacgtagttcaagtattgttgtagtt |
31832568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University