View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6334_high_3 (Length: 418)
Name: NF6334_high_3
Description: NF6334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6334_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 345; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 20 - 364
Target Start/End: Original strand, 6216675 - 6217019
Alignment:
| Q |
20 |
gactggtggcagggtatgttatgagttatgacaaatacttgtctaattagatttttgtggtataaaaatgtttgcctatatgtgataatattctcattct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6216675 |
gactggtggcagggtatgttatgagttatgacaaatacttgtctaattagatttttgtggtataaaaatgtttgcctatatgtgataatattctcattct |
6216774 |
T |
|
| Q |
120 |
tttactatcttgttatcttttgattcacaggaagtctctattattgaaatcatccttgtcaactctaggcatatgcttcatcaggtatatatcatattat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6216775 |
tttactatcttgttatcttttgattcacaggaagtctctattattgaaatcatccttgtcaactctaggcatatgcttcatcaggtatatatcatattat |
6216874 |
T |
|
| Q |
220 |
gaaacctatatccaagtgacacatatatttcatgcataattattttaagagtgcaattatagtcacataattttctcttttttaatctctaaatttaaca |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6216875 |
gaaacctatatccaagtgacacatatatttcatgcataattattttaagagtgcaattatagtcacataattttctcttttttaatctctaaatttaaca |
6216974 |
T |
|
| Q |
320 |
tagtttgaaaagtaaaatgtcttcgcatgatgtatcatactaagc |
364 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6216975 |
tagtttgaaaagtaaaatgtcttcgcatgatgtatcatactaagc |
6217019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 381 - 410
Target Start/End: Original strand, 6217032 - 6217061
Alignment:
| Q |
381 |
gagattttatcttttataattaagtataat |
410 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6217032 |
gagattttatcttttataattaagtataat |
6217061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University