View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6334_low_6 (Length: 214)
Name: NF6334_low_6
Description: NF6334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6334_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 64; Significance: 4e-28; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 135 - 198
Target Start/End: Original strand, 999959 - 1000022
Alignment:
| Q |
135 |
ttagcacattaatctaacttatattaatgtaaatcaagacactaatgtaagcatagaaatagat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
999959 |
ttagcacattaatctaacttatattaatgtaaatcaagacactaatgtaagcatagaaatagat |
1000022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 13 - 89
Target Start/End: Original strand, 999837 - 999913
Alignment:
| Q |
13 |
aatatccaaagaacgactttagaagtattgcattatgattttagtacctttgagttttcaacttacttagagttatg |
89 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
999837 |
aatatccaaagaacgaatttagaagtactgcattatgattatagtacctttgagttttcaacttacatagagttatg |
999913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 135 - 197
Target Start/End: Complemental strand, 6969261 - 6969199
Alignment:
| Q |
135 |
ttagcacattaatctaacttatattaatgtaaatcaagacactaatgtaagcatagaaataga |
197 |
Q |
| |
|
|||||| |||||||||||||||| ||| |||||| ||||| | |||||||||||||||||||| |
|
|
| T |
6969261 |
ttagcatattaatctaacttataataaagtaaattaagactcgaatgtaagcatagaaataga |
6969199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University