View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6335_low_11 (Length: 243)
Name: NF6335_low_11
Description: NF6335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6335_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 18 - 105
Target Start/End: Original strand, 23480933 - 23481020
Alignment:
| Q |
18 |
tataaaacatttaacattaatttcaatcttatcaataaatggcttcttgcaactcttaagtgttaaaacctatttaattaaagataac |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23480933 |
tataaaacatttaacattaatttcaatcttataaataaatggcttcttgcaactcttaagtgttaaaacctatttaattaaagataac |
23481020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 134 - 172
Target Start/End: Original strand, 23481078 - 23481116
Alignment:
| Q |
134 |
agtgaaaaaatatggctcatactatcatgtttacttatg |
172 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
23481078 |
agtgaaaaaatatggctcatattctcatgtttacttatg |
23481116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 52 - 105
Target Start/End: Complemental strand, 9261000 - 9260947
Alignment:
| Q |
52 |
ataaatggcttcttgcaactcttaagtgttaaaacctatttaattaaagataac |
105 |
Q |
| |
|
||||||||||||||||||| | |||||| ||||| |||||||||| ||| |||| |
|
|
| T |
9261000 |
ataaatggcttcttgcaacacataagtgctaaaaactatttaatttaagctaac |
9260947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University