View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6335_low_9 (Length: 257)
Name: NF6335_low_9
Description: NF6335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6335_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 11 - 235
Target Start/End: Original strand, 23481181 - 23481406
Alignment:
| Q |
11 |
ctaatttatcttggatacaatatgtcatcacattttagtnnnnnnnnn-tcttcttgtttgacattgtaggtaaattttcatgtaagacaatatttgatt |
109 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| ||| |
|
|
| T |
23481181 |
ctaatttatcttggatacaatatttcatcacattttagtaaaaaaaaaatcttcttgtttgacaatgtaggtaaattttcatgtaagacaatatttaatt |
23481280 |
T |
 |
| Q |
110 |
gtccagcccttgtatatcatatatatgggagttgccttgatggtttttgttggtacgaggaaaagtttgaggatgaatgatgcagaaggatgttctttct |
209 |
Q |
| |
|
|||||||||||||||||||| | ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23481281 |
gtccagcccttgtatatcatcaacatgcgagttgccttgatggtttttgttggtacgaggaaaagtttgaggatgaatgatgcagaaggatgttctttct |
23481380 |
T |
 |
| Q |
210 |
ttgttactattgtgttgcagattgtg |
235 |
Q |
| |
|
|| |||||||| || ||||||||||| |
|
|
| T |
23481381 |
ttattactattctgctgcagattgtg |
23481406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University