View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6336_high_11 (Length: 359)
Name: NF6336_high_11
Description: NF6336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6336_high_11 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 22 - 359
Target Start/End: Original strand, 28309837 - 28310174
Alignment:
| Q |
22 |
tggctcccttcctccgtcttcctcggctcctatcatagtggctacggctgggtggatgctgaagctcagcctgtctcttgtggccacaacaacactgcta |
121 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||| ||||||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28309837 |
tggctcccttcctccttcttcctcggctcctatcacagtggctacggccgggtggatgttgaagctcagcctgtctcttatggccacaacaacactgcta |
28309936 |
T |
|
| Q |
122 |
gcattttcactagcaatattctcctcctcccttgtaaacacatgttgcaaaaaccaaattgtgggactcacgattttctcgaacttttcattctttgcaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28309937 |
gcattttcactagcaatattctcctcctcccttgtaaacacatgttgcaaaaaccaaattgtgggactcacgattttctcgaacttttcattctttgcaa |
28310036 |
T |
|
| Q |
222 |
gtatcttcatgtctcatggcctcaaaagcgacctcggtgcaccaaacatttacaagaccaggaccagctgcctttgggctgatatgatactttggattta |
321 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
28310037 |
gtatcttcatgtcttatggcctcaaaagcgacctcggtgcaccaaacatttacaagaccaggaccagctgcctttgggttgatatgatactttgggttta |
28310136 |
T |
|
| Q |
322 |
taatgttgtatgtggcttgtgttccctcttcattgtct |
359 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
28310137 |
taatgttgtatgtggcttgtgccacctcttcactgtct |
28310174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University