View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6336_high_16 (Length: 296)
Name: NF6336_high_16
Description: NF6336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6336_high_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 7e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 21 - 233
Target Start/End: Original strand, 22569546 - 22569756
Alignment:
| Q |
21 |
acttgagtaaaccctttgtaatatatatgatatgggagttcaactaactaattaacggtattattgttggttaggtacttagttgcataactcactaaag |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22569546 |
acttgagtaaaccctttgtaatatatatgatatgggagttcaactaactaattaacggtattcttgttggttaggtacttagttgcataactcactaaag |
22569645 |
T |
|
| Q |
121 |
tcttcttataatgttgttcacnnnnnnnnnnnacagtaagtgttgtaaatgaaaatagataataattagatttatatatattttgtactttgtagagctc |
220 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22569646 |
tcttcttataatgttgttcac--tttttttttacagtaagtgttgtaaatgaaaatagataataattagatttatatatattttgtactttgtagagctc |
22569743 |
T |
|
| Q |
221 |
ttgatttttaatt |
233 |
Q |
| |
|
||||||||||||| |
|
|
| T |
22569744 |
ttgatttttaatt |
22569756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 217 - 267
Target Start/End: Original strand, 22569757 - 22569807
Alignment:
| Q |
217 |
gctcttgatttttaatttggctagttattcagaacagaagtgcctcaataa |
267 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
22569757 |
gctcttgatttttaatttggctggttattcagaacagaagtgccttaataa |
22569807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University