View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6336_high_20 (Length: 272)
Name: NF6336_high_20
Description: NF6336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6336_high_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 61 - 256
Target Start/End: Complemental strand, 22058503 - 22058308
Alignment:
| Q |
61 |
ccatatgctcttttcaattgaaataatcatattcgagacgcgttgaatagtatatatgcctattttctgcatataaaacatttaaagaaaacaacaacta |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22058503 |
ccatatgctcttttcaattgaaataatcatattcgagacgcgttgaatagtatatatacctcttttctgcatataaaacatttaaagaaaacaacaacta |
22058404 |
T |
 |
| Q |
161 |
gactaactaaacggggacaagaacccctccatcttcttcaataataatgctaaggtggatagccataccatgcataatagtttaagtaaatattat |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22058403 |
gactaactaaacggggacaagaacccctccatcttcttcaataataatgctaaggtggatagccataccatgcataatagtttaagtaaatattat |
22058308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University