View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6336_high_22 (Length: 264)
Name: NF6336_high_22
Description: NF6336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6336_high_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 22570003 - 22570230
Alignment:
| Q |
1 |
caatttcacataattgttctgttacattttgaggttttgatataaggctgtagtatttctattgaagcttgattttctccttttttaaaaatcatcggaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22570003 |
caatttcacataattgttctgttacattttgaggttttgatataaggctgtagtatttctattgaagcttgattttctccttttttaaaaatcatcggaa |
22570102 |
T |
 |
| Q |
101 |
agttaccggaagagtc-------------tatggcaaactaatgttaaaattttcgttgaga-gtgtctatgtttgatgtttggtggtgcctcaaatagg |
186 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22570103 |
agttaccggaagagtctaatctctcataatatggcaaactaatgttaaaattttcgttgagaggtgtctatgtttgatgtttggtggtgcctcaaatagg |
22570202 |
T |
 |
| Q |
187 |
atcatcttcggtggaagaaacttgtgat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
22570203 |
atcatcttcggtggaagaaacttgtgat |
22570230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University