View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6336_low_13 (Length: 327)

Name: NF6336_low_13
Description: NF6336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6336_low_13
NF6336_low_13
[»] chr7 (1 HSPs)
chr7 (104-287)||(45977236-45977417)


Alignment Details
Target: chr7 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 104 - 287
Target Start/End: Complemental strand, 45977417 - 45977236
Alignment:
104 atcttggattattgcattgtcacttgcagtcgtacattgtatccctgacatatctttcgcgatgagtagtttttccgttaatatatttccttactcaata 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45977417 atcttggattattgcattgtcacttgcagtcgtacattgtatccctgacatatctttcgcgatgagtagtttttccgttaatatatttccttactcaata 45977318  T
204 aaatcgatgccataaagaactaaaatagagtcttgtaagtgtcggtggccggtgggttgctagtttcatggacattggtataca 287  Q
    ||||||||||  || |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
45977317 aaatcgatgc--tatagaactaaaatagagtcttgtaagtgtcggtggccggtgggttgctggtttcatggacattggtataca 45977236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University