View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6336_low_13 (Length: 327)
Name: NF6336_low_13
Description: NF6336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6336_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 104 - 287
Target Start/End: Complemental strand, 45977417 - 45977236
Alignment:
| Q |
104 |
atcttggattattgcattgtcacttgcagtcgtacattgtatccctgacatatctttcgcgatgagtagtttttccgttaatatatttccttactcaata |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45977417 |
atcttggattattgcattgtcacttgcagtcgtacattgtatccctgacatatctttcgcgatgagtagtttttccgttaatatatttccttactcaata |
45977318 |
T |
|
| Q |
204 |
aaatcgatgccataaagaactaaaatagagtcttgtaagtgtcggtggccggtgggttgctagtttcatggacattggtataca |
287 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45977317 |
aaatcgatgc--tatagaactaaaatagagtcttgtaagtgtcggtggccggtgggttgctggtttcatggacattggtataca |
45977236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University