View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6336_low_17 (Length: 293)
Name: NF6336_low_17
Description: NF6336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6336_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 12 - 241
Target Start/End: Complemental strand, 32032613 - 32032384
Alignment:
| Q |
12 |
atgaactgagacagataaaaagtcggtaccaaagtagaagtagttctgacgccttgagacctgcagtttcaattagacgcgtaataaccctcatcacggg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32032613 |
atgaactgagacagataaaaagtcggtaccaaagtggaggtagttctgacgccttgagacctgcagtttcaattagacgcgtaataaccctcatcgcggg |
32032514 |
T |
|
| Q |
112 |
atgagtcaaatatgttagtaacatagacccctgagggttatcagaaccaaatgaagcagaccctttcgagtttatgaaaccgatcaccaaattatatgac |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32032513 |
atgagtcaaatatgttagtaacatagacccctgagggttatcagaaccaaatgaagcagaccctttcgagtttatgaaaccgatcaccgaattatatgac |
32032414 |
T |
|
| Q |
212 |
aaatctgcacccacccaatctttaagcaag |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32032413 |
aaatctgcacccacccaatctttaagcaag |
32032384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University