View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6336_low_26 (Length: 251)
Name: NF6336_low_26
Description: NF6336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6336_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 97; Significance: 9e-48; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 132 - 244
Target Start/End: Original strand, 27428189 - 27428301
Alignment:
| Q |
132 |
gaacgcaaggattgtgagaaataagaagtaaaaagagttcaattatgtatataagaaaatgaatcatcacttaaataatcattctcattgctctaaatta |
231 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
27428189 |
gaacgcaaggattgtgagaactaagaagtaaaaagagttcaactatgtatataagaaaatgaatcatcacttaaacaatcattctgattgctctaaatta |
27428288 |
T |
 |
| Q |
232 |
attgtttcatctc |
244 |
Q |
| |
|
||||||||||||| |
|
|
| T |
27428289 |
attgtttcatctc |
27428301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University