View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6336_low_26 (Length: 251)

Name: NF6336_low_26
Description: NF6336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6336_low_26
NF6336_low_26
[»] chr5 (1 HSPs)
chr5 (132-244)||(27428189-27428301)


Alignment Details
Target: chr5 (Bit Score: 97; Significance: 9e-48; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 132 - 244
Target Start/End: Original strand, 27428189 - 27428301
Alignment:
132 gaacgcaaggattgtgagaaataagaagtaaaaagagttcaattatgtatataagaaaatgaatcatcacttaaataatcattctcattgctctaaatta 231  Q
    |||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||    
27428189 gaacgcaaggattgtgagaactaagaagtaaaaagagttcaactatgtatataagaaaatgaatcatcacttaaacaatcattctgattgctctaaatta 27428288  T
232 attgtttcatctc 244  Q
    |||||||||||||    
27428289 attgtttcatctc 27428301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University