View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6337_low_5 (Length: 310)
Name: NF6337_low_5
Description: NF6337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6337_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 13 - 268
Target Start/End: Complemental strand, 44706987 - 44706737
Alignment:
| Q |
13 |
catcacgccatttgaaaattatcagctgccccctgaagctcaaccatttagtcctgtaagcacctaagttagtttttatttgttcattgtgcctataata |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44706987 |
catcacgccatttgaaaattatcagctgccccctgaagctcaaccatttagtcctgtaagcacctaagttagtttttatttgttcattgtgcctataata |
44706888 |
T |
|
| Q |
113 |
aataccagtatcgaattatcttagcagtaaaagactcatttatttagcagattttgaaacattgcttcacaattgcagataaatttctaagatgtatcat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44706887 |
----ccagtatcgaattatcttagcagtaaaagactcatttatttagcagattttgaaacattgcttcacaattgcagataaatttctaagatgtatcat |
44706792 |
T |
|
| Q |
213 |
ttannnnnnnatgttagaaacacacacttgcaatgtttctttcgtacctgatattt |
268 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
44706791 |
tta-ttttttatgttagaaacacacacttgcaatgtttctttcgtatctaatattt |
44706737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University