View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6337_low_6 (Length: 264)
Name: NF6337_low_6
Description: NF6337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6337_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 41 - 248
Target Start/End: Complemental strand, 49055530 - 49055323
Alignment:
| Q |
41 |
atcacggtcagggtttaaaaacactacttgaacttgaacatattattacctaatgtgaagggatcacttagcgtatgtttgagaagtatatggtaaacgt |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
49055530 |
atcacggtcagggtttaaaaacactacttgaacttgaacatattattacctaatgtgaagggatcacttagcgtatgtttgagaaatatatggtaaacgt |
49055431 |
T |
|
| Q |
141 |
gcttttaaatcttgacgtgcgtctggcatgaagttattctttgtagcttgtttttcacggnnnnnnnnccttattttaggtgttgttcataatttggtgt |
240 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
49055430 |
gcttttagatcttgacgtgcgtctggcatgaagttattctttgtagcttgtttttcacggaaaaaaaaccttattttaggtgttgttcataatttggtgt |
49055331 |
T |
|
| Q |
241 |
gtctgttc |
248 |
Q |
| |
|
|||||||| |
|
|
| T |
49055330 |
gtctgttc |
49055323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University