View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6337_low_8 (Length: 251)
Name: NF6337_low_8
Description: NF6337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6337_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 11 - 147
Target Start/End: Complemental strand, 28422186 - 28422050
Alignment:
| Q |
11 |
tcccaaaatcataaacaatgaattttagatattgattatcatggtgtttgttagctattgttagagatcgaaaaaatgttttggtgacttttgatgctct |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28422186 |
tcccaaaatcataaacaatgaattttagatattgattatcatggtgtttgttagctattgttagagatcgaaaaaatgttttggtgacttttgatgctct |
28422087 |
T |
 |
| Q |
111 |
ataagtaaactgaaattggtttgcacctcttgtcctc |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28422086 |
ataagtaaactgaaattggtttgcacctcttgtcctc |
28422050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 180 - 241
Target Start/End: Complemental strand, 28422018 - 28421957
Alignment:
| Q |
180 |
ccggtgcctacaaatgataggtggtggtcttaagatgccatttctgatatataaggtctctg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28422018 |
ccggtgcctacaaatgataggtggtggtcttaagatgccatttctgatatataaggtctctg |
28421957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University