View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6338_low_6 (Length: 207)
Name: NF6338_low_6
Description: NF6338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6338_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 58; Significance: 1e-24; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 83 - 191
Target Start/End: Original strand, 45758700 - 45758813
Alignment:
| Q |
83 |
cttttgtgaagactgaacaatttagtgtactttattnnnnnnnn-----gtgagtcatgatttattttgatcttttttcatcgttttaagagtttcggta |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
45758700 |
cttttgtgaagactgaacaatttagtgtacttcattaaaaaaaaaaaaagtgagtcatgatttattttgatcttttttcatcattttaagagtttgggta |
45758799 |
T |
|
| Q |
178 |
aggatcattggcat |
191 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
45758800 |
aggatcattggcat |
45758813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 18 - 64
Target Start/End: Original strand, 45758633 - 45758679
Alignment:
| Q |
18 |
aatatatggttgagaagtatgaccaagaaattttttgtgaaggttac |
64 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45758633 |
aatatatggttgagaaatatgaccaagaaattttttgtgaaggttac |
45758679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University